Skip to main content

Stem loop RT-PCR for Detection of siRNA in Animal Tissues

Step Loop RT-PCR for Detection of Small Interfering RNA (siRNA)

The recent publications described a novel used the novel method for the detection of siRNAs using a TaqMan®-based approach. This approach utilizes similar strategy that has been used for microRNA detection. The approach is illustrated in below.  In brief, the RT step occurs in the presence of a stem-loop RT primer that is complementary to the last 6–10 bases of the 3′ end of the antisense strand of the target siRNA. The stem-loop primer contains an additional universal sequence at the 5′ end that facilitates a TaqMan-based detection strategy in the subsequent qPCR step. As in the case of microRNA, the forward primer for qPCR is sequence-specific for the target siRNA. For sequence compositions that yield a low predicted melting temperature (Tm), the forward primer is designed as a tailed primer to help increase Tm.


Stem Loop PCR for SiRNA Detection

Stem Loop PCR for SiRNA Detection


Step 1: Preparation of liver and plasma samples for the quantification of siRNA

For tissue, 500 μl of 0.25% Triton X-100 at 95°C was added directly into each 50 mg frozen powdered tissue sample. Lysates were vortexed and put back into the 95°C hot block for a total incubation time of 10 min. Lysates were vortexed twice more during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.

For plasma, plasma samples were diluted 1:10 in 0.25% Triton X-100. Then, 500 μl from each diluted plasma sample was heated at 95°C for a total incubation time of 10 min and vortexed twice during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.

All tissue and plasma lysates were centrifuged at 20,000 g for 20 min at 4°C and supernatants taken into clean Eppendorf tubes and kept on ice.

Reverse transcription preparation of cDNA

To determine tissue siRNA concentrations, ∼10 mg of powdered tissue was resuspended to a final concentration of 10 mg/mL in PBST. Diluted samples were incubated on a dry block (VWR® Advanced dry block heater; VWR) at 95°C for 10 min, vortexed, and placed on ice for 10 min before centrifugation at 16,000 g for 10 min at 4°C. Supernatants were transferred to 1.5 mL DNase/RNase-free tubes (Eppendorf, NY) and analyzed immediately or frozen until analysis.

A minimum of 20 μL of samples (plasma, serum, or liver), standards, and QCs was then transferred into a 96-well plate and placed into a preheated thermal cycler (Mastercycler®; Eppendorf) at 95°C for 10 min to allow the duplexes to denature and facilitate the annealing of the stem-loop primer to the antisense strand of the siRNA during the reverse transcription (RT) reaction.


Reverse transcription reactions

Reverse transcription reactions were performed using a TaqMan MicroRNA Reverse Transcription kit 200 (Applied Biosystems of Life Technologies, cat # 4366596).

It is recommended to use two adjacent PCR machines for the procedure. One PCR machine for heating the 'boiling plate' and the second for the 'RT plate', as detailed below.

A total of 50 μl from each standard curve point (single strand, duplex and formulated duplex), one naïve (for background) and sample lysates were aliquoted into one PCR plate ('boiling plate') and heated at 95°C for 10 min on one PCR machine. Then, 10 μl of RT reaction mix (100 mmol deoxyribonucleotide triphosphates, 250 nmol stem and loop oligonucleotides, 20 U/μl RNase inhibitor, 1 × RT buffer, 50 U/μl MultiScribe Reverse Transcriptase) was aliquoted into each well of the 'RT plate', which was placed on the second adjacent PCR machine and kept at 4°C. Following 10 min of heating, the cover from the 'boiling plate' was removed and, while the plate was kept on the heating block, 5 μl from each hot sample was directly added into the RT reaction mix (at 4°C) on the 'RT plate' and the program was switched onto the RT program (30 min, 16°C, 30 min, 42°C, 5 min, 85°C).


PCR amplification

The qPCR step was then performed on a ViiA 7 Real-Time PCR System (Applied Biosystems; ThermoFisher Scientific) using a 384-well block and TaqMan™ Fast Advanced Master Mix (ThermoFisher Scientific) according to the manufacturer's protocols.

Primer
For the stem-loop primer, the universal sequence (5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC 3′) was used. Taqman probe, forward and reverse primer were designed based on the sequence.


Reference and Related Publications
https://doi.org/10.1089/nat.2019.0840
https://doi.org/10.1093/nar/gni178
https://doi.org/10.1186/1758-907X-1-16
https://doi.org/10.1016/j.ymthe.2017.12.021

Popular posts from this blog

Human Genome Editing: FDA Draft Guidance Summary

Consideration for Developing Gene Editing Product  1. Genome Editing Methods: Genome editing can be achieved through nuclease-dependent or nuclease-independent methods. Nuclease-dependent methods involve introducing site-specific breaks in DNA using technologies like zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), modified-homing endonucleases, and CRISPR-associated (Cas) nucleases. These breaks can lead to modification of the DNA sequence at the cleavage site. Nuclease-independent methods can change DNA sequences without cleaving the DNA and include techniques like base editing and synthetic triplex-forming peptide nucleic acids. The choice of GE technology should consider factors such as the mechanism of action, the ability to target specific DNA sequences, and the potential to optimize components for efficiency, specificity, or stability. 2. Type and Degree of Genomic Modification: Different GE approaches rely on DNA repair pathways such a...

Stem-Loop PCR for siRNA

 Stem-loop PCR is a method often used for detecting and quantifying small RNAs, such as siRNA or miRNA, which are typically difficult to amplify directly due to their short lengths. The method involves the design of a stem-loop reverse transcription (RT) primer, which enhances specificity and stability of the short RNA during the RT-PCR process, allowing for sensitive detection and quantification of the siRNA. Here’s a detailed guide to how stem-loop PCR can be applied to siRNA detection: Key Steps in Stem-Loop PCR for siRNA Designing the Stem-Loop RT Primer : Structure : The stem-loop RT primer consists of a loop region flanked by complementary sequences on either side (the "stem"), which will fold back on itself to form a hairpin structure. Specific Binding Region : A short sequence complementary to the 3’ end of the siRNA is added at the end of the stem-loop primer to ensure specific binding to the siRNA target. Stabilization : The loop structure helps prevent primer-dimer...

Allometric scaling in AAV gene therapy dose estimation

 Allometric scaling in AAV gene therapy dose estimation is crucial for translating effective and safe doses from animal models to humans. Since AAV dosing often involves high viral vector concentrations, proper dose scaling is essential to minimize adverse effects and optimize therapeutic outcomes. Here’s a breakdown of how allometric scaling is applied in AAV gene therapy dosing and the considerations involved: 1. Concept of Allometric Scaling Allometric scaling is a method of adjusting drug doses across species based on body size, physiology, and metabolism. It is especially useful in biologics and gene therapies where the pharmacokinetics and pharmacodynamics are more complex than small-molecule drugs. For AAV vectors, dosing is commonly scaled by body weight (e.g., vector genomes [vg] per kilogram) or body surface area (BSA), as these parameters can approximate dose distribution and vector exposure across different species. 2. Standard Scaling Approaches Body Weight Scaling (mg...

Guideline on development and manufacture of lentiviral vectors (CHMP/BWP/2458/03)

The guideline with the reference number "CHMP/BWP/2458/03" pertains to the "Guideline on Development and Manufacture of Lentiviral Vectors." This guideline was developed by the Committee for Medicinal Products for Human Use (CHMP) and the Biotechnology Working Party (BWP) of the European Medicines Agency (EMA). It provides recommendations and regulatory guidance for the development and manufacture of lentiviral vectors, which are widely used in gene therapy and cell therapy applications. Here's an overview of the key points covered in this guideline: 1. Introduction: The guideline begins with an introduction highlighting the increasing importance of lentiviral vectors in advanced therapies and the need for guidance on their development and manufacture. 2. Scope: It defines the scope of the guideline, which covers the development and manufacture of lentiviral vectors intended for use in gene therapy and cell therapy products for human use. 3. Quality and Characte...