Step Loop RT-PCR for Detection of Small Interfering RNA (siRNA)
The recent publications described a novel used the novel method for the detection of siRNAs using a TaqMan®-based approach. This approach utilizes similar strategy that has been used for microRNA detection. The approach is illustrated in below. In brief, the RT step occurs in the presence of a stem-loop RT primer that is complementary to the last 6–10 bases of the 3′ end of the antisense strand of the target siRNA. The stem-loop primer contains an additional universal sequence at the 5′ end that facilitates a TaqMan-based detection strategy in the subsequent qPCR step. As in the case of microRNA, the forward primer for qPCR is sequence-specific for the target siRNA. For sequence compositions that yield a low predicted melting temperature (Tm), the forward primer is designed as a tailed primer to help increase Tm.
Stem Loop PCR for SiRNA Detection
Step 1: Preparation of liver and plasma samples for the quantification of siRNA
For tissue, 500 μl of 0.25% Triton X-100 at 95°C was added directly into each 50 mg frozen powdered tissue sample. Lysates were vortexed and put back into the 95°C hot block for a total incubation time of 10 min. Lysates were vortexed twice more during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.
For plasma, plasma samples were diluted 1:10 in 0.25% Triton X-100. Then, 500 μl from each diluted plasma sample was heated at 95°C for a total incubation time of 10 min and vortexed twice during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.
All tissue and plasma lysates were centrifuged at 20,000 g for 20 min at 4°C and supernatants taken into clean Eppendorf tubes and kept on ice.
Reverse transcription preparation of cDNA
To determine tissue siRNA concentrations, ∼10 mg of powdered tissue was resuspended to a final concentration of 10 mg/mL in PBST. Diluted samples were incubated on a dry block (VWR® Advanced dry block heater; VWR) at 95°C for 10 min, vortexed, and placed on ice for 10 min before centrifugation at 16,000 g for 10 min at 4°C. Supernatants were transferred to 1.5 mL DNase/RNase-free tubes (Eppendorf, NY) and analyzed immediately or frozen until analysis.
A minimum of 20 μL of samples (plasma, serum, or liver), standards, and QCs was then transferred into a 96-well plate and placed into a preheated thermal cycler (Mastercycler®; Eppendorf) at 95°C for 10 min to allow the duplexes to denature and facilitate the annealing of the stem-loop primer to the antisense strand of the siRNA during the reverse transcription (RT) reaction.
Reverse transcription reactions
Reverse transcription reactions were performed using a TaqMan MicroRNA Reverse Transcription kit 200 (Applied Biosystems of Life Technologies, cat # 4366596).
A minimum of 20 μL of samples (plasma, serum, or liver), standards, and QCs was then transferred into a 96-well plate and placed into a preheated thermal cycler (Mastercycler®; Eppendorf) at 95°C for 10 min to allow the duplexes to denature and facilitate the annealing of the stem-loop primer to the antisense strand of the siRNA during the reverse transcription (RT) reaction.
Reverse transcription reactions
Reverse transcription reactions were performed using a TaqMan MicroRNA Reverse Transcription kit 200 (Applied Biosystems of Life Technologies, cat # 4366596).
It is recommended to use two adjacent PCR machines for the procedure. One PCR machine for heating the 'boiling plate' and the second for the 'RT plate', as detailed below.
A total of 50 μl from each standard curve point (single strand, duplex and formulated duplex), one naïve (for background) and sample lysates were aliquoted into one PCR plate ('boiling plate') and heated at 95°C for 10 min on one PCR machine. Then, 10 μl of RT reaction mix (100 mmol deoxyribonucleotide triphosphates, 250 nmol stem and loop oligonucleotides, 20 U/μl RNase inhibitor, 1 × RT buffer, 50 U/μl MultiScribe Reverse Transcriptase) was aliquoted into each well of the 'RT plate', which was placed on the second adjacent PCR machine and kept at 4°C. Following 10 min of heating, the cover from the 'boiling plate' was removed and, while the plate was kept on the heating block, 5 μl from each hot sample was directly added into the RT reaction mix (at 4°C) on the 'RT plate' and the program was switched onto the RT program (30 min, 16°C, 30 min, 42°C, 5 min, 85°C).
PCR amplification
The qPCR step was then performed on a ViiA 7 Real-Time PCR System (Applied Biosystems; ThermoFisher Scientific) using a 384-well block and TaqMan™ Fast Advanced Master Mix (ThermoFisher Scientific) according to the manufacturer's protocols.
Primer
For the stem-loop primer, the universal sequence (5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC 3′) was used. Taqman probe, forward and reverse primer were designed based on the sequence.
A total of 50 μl from each standard curve point (single strand, duplex and formulated duplex), one naïve (for background) and sample lysates were aliquoted into one PCR plate ('boiling plate') and heated at 95°C for 10 min on one PCR machine. Then, 10 μl of RT reaction mix (100 mmol deoxyribonucleotide triphosphates, 250 nmol stem and loop oligonucleotides, 20 U/μl RNase inhibitor, 1 × RT buffer, 50 U/μl MultiScribe Reverse Transcriptase) was aliquoted into each well of the 'RT plate', which was placed on the second adjacent PCR machine and kept at 4°C. Following 10 min of heating, the cover from the 'boiling plate' was removed and, while the plate was kept on the heating block, 5 μl from each hot sample was directly added into the RT reaction mix (at 4°C) on the 'RT plate' and the program was switched onto the RT program (30 min, 16°C, 30 min, 42°C, 5 min, 85°C).
PCR amplification
The qPCR step was then performed on a ViiA 7 Real-Time PCR System (Applied Biosystems; ThermoFisher Scientific) using a 384-well block and TaqMan™ Fast Advanced Master Mix (ThermoFisher Scientific) according to the manufacturer's protocols.
Primer
For the stem-loop primer, the universal sequence (5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC 3′) was used. Taqman probe, forward and reverse primer were designed based on the sequence.
Reference and Related Publications
https://doi.org/10.1089/nat.2019.0840
https://doi.org/10.1093/nar/gni178
https://doi.org/10.1186/1758-907X-1-16
https://doi.org/10.1016/j.ymthe.2017.12.021