Skip to main content

Stem loop RT-PCR for Detection of siRNA in Animal Tissues

Step Loop RT-PCR for Detection of Small Interfering RNA (siRNA)

The recent publications described a novel used the novel method for the detection of siRNAs using a TaqMan®-based approach. This approach utilizes similar strategy that has been used for microRNA detection. The approach is illustrated in below.  In brief, the RT step occurs in the presence of a stem-loop RT primer that is complementary to the last 6–10 bases of the 3′ end of the antisense strand of the target siRNA. The stem-loop primer contains an additional universal sequence at the 5′ end that facilitates a TaqMan-based detection strategy in the subsequent qPCR step. As in the case of microRNA, the forward primer for qPCR is sequence-specific for the target siRNA. For sequence compositions that yield a low predicted melting temperature (Tm), the forward primer is designed as a tailed primer to help increase Tm.


Stem Loop PCR for SiRNA Detection

Stem Loop PCR for SiRNA Detection


Step 1: Preparation of liver and plasma samples for the quantification of siRNA

For tissue, 500 μl of 0.25% Triton X-100 at 95°C was added directly into each 50 mg frozen powdered tissue sample. Lysates were vortexed and put back into the 95°C hot block for a total incubation time of 10 min. Lysates were vortexed twice more during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.

For plasma, plasma samples were diluted 1:10 in 0.25% Triton X-100. Then, 500 μl from each diluted plasma sample was heated at 95°C for a total incubation time of 10 min and vortexed twice during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.

All tissue and plasma lysates were centrifuged at 20,000 g for 20 min at 4°C and supernatants taken into clean Eppendorf tubes and kept on ice.

Reverse transcription preparation of cDNA

To determine tissue siRNA concentrations, ∼10 mg of powdered tissue was resuspended to a final concentration of 10 mg/mL in PBST. Diluted samples were incubated on a dry block (VWR® Advanced dry block heater; VWR) at 95°C for 10 min, vortexed, and placed on ice for 10 min before centrifugation at 16,000 g for 10 min at 4°C. Supernatants were transferred to 1.5 mL DNase/RNase-free tubes (Eppendorf, NY) and analyzed immediately or frozen until analysis.

A minimum of 20 μL of samples (plasma, serum, or liver), standards, and QCs was then transferred into a 96-well plate and placed into a preheated thermal cycler (Mastercycler®; Eppendorf) at 95°C for 10 min to allow the duplexes to denature and facilitate the annealing of the stem-loop primer to the antisense strand of the siRNA during the reverse transcription (RT) reaction.


Reverse transcription reactions

Reverse transcription reactions were performed using a TaqMan MicroRNA Reverse Transcription kit 200 (Applied Biosystems of Life Technologies, cat # 4366596).

It is recommended to use two adjacent PCR machines for the procedure. One PCR machine for heating the 'boiling plate' and the second for the 'RT plate', as detailed below.

A total of 50 μl from each standard curve point (single strand, duplex and formulated duplex), one naïve (for background) and sample lysates were aliquoted into one PCR plate ('boiling plate') and heated at 95°C for 10 min on one PCR machine. Then, 10 μl of RT reaction mix (100 mmol deoxyribonucleotide triphosphates, 250 nmol stem and loop oligonucleotides, 20 U/μl RNase inhibitor, 1 × RT buffer, 50 U/μl MultiScribe Reverse Transcriptase) was aliquoted into each well of the 'RT plate', which was placed on the second adjacent PCR machine and kept at 4°C. Following 10 min of heating, the cover from the 'boiling plate' was removed and, while the plate was kept on the heating block, 5 μl from each hot sample was directly added into the RT reaction mix (at 4°C) on the 'RT plate' and the program was switched onto the RT program (30 min, 16°C, 30 min, 42°C, 5 min, 85°C).


PCR amplification

The qPCR step was then performed on a ViiA 7 Real-Time PCR System (Applied Biosystems; ThermoFisher Scientific) using a 384-well block and TaqMan™ Fast Advanced Master Mix (ThermoFisher Scientific) according to the manufacturer's protocols.

Primer
For the stem-loop primer, the universal sequence (5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC 3′) was used. Taqman probe, forward and reverse primer were designed based on the sequence.


Reference and Related Publications
https://doi.org/10.1089/nat.2019.0840
https://doi.org/10.1093/nar/gni178
https://doi.org/10.1186/1758-907X-1-16
https://doi.org/10.1016/j.ymthe.2017.12.021

Popular posts from this blog

Ago2 Immunoprecipitation for RISC-siRNA Quantitation

 Ago2 (Argonaute 2) immunoprecipitation (IP) is a technique used to isolate RNA-induced silencing complexes (RISC) from cell lysates. This method allows for the specific enrichment of active RISC complexes bound to small interfering RNA (siRNA) or microRNA (miRNA) within cells. By isolating these complexes, researchers can then quantify the siRNA associated with Ago2, which is an essential step in determining the efficacy of RISC loading and siRNA activity. Here’s a detailed overview of how Ago2 immunoprecipitation is performed for RISC-siRNA quantitation: Steps in Ago2 Immunoprecipitation for RISC-siRNA Quantitation Cell Lysis and Preparation of Lysate : Sample Preparation : Collect cells that have been treated with siRNA, then wash them with cold phosphate-buffered saline (PBS) to remove extracellular contaminants. Lysis : Lyse the cells in a gentle, RNA-preserving lysis buffer that typically includes detergents (e.g., NP-40 or Triton X-100), protease inhibitors, and RNase inhibi...

Guideline on development and manufacture of lentiviral vectors (CHMP/BWP/2458/03)

The guideline with the reference number "CHMP/BWP/2458/03" pertains to the "Guideline on Development and Manufacture of Lentiviral Vectors." This guideline was developed by the Committee for Medicinal Products for Human Use (CHMP) and the Biotechnology Working Party (BWP) of the European Medicines Agency (EMA). It provides recommendations and regulatory guidance for the development and manufacture of lentiviral vectors, which are widely used in gene therapy and cell therapy applications. Here's an overview of the key points covered in this guideline: 1. Introduction: The guideline begins with an introduction highlighting the increasing importance of lentiviral vectors in advanced therapies and the need for guidance on their development and manufacture. 2. Scope: It defines the scope of the guideline, which covers the development and manufacture of lentiviral vectors intended for use in gene therapy and cell therapy products for human use. 3. Quality and Characte...

ICH Q5D Derivation and characterisation of cell substrates used for production of biotechnological/biological products (CPMP/ICH/294/95)

The International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH) provides guidelines to ensure the quality, safety, and efficacy of pharmaceutical products. ICH Q5D, as outlined in document CPMP/ICH/294/95, addresses the derivation and characterization of cell substrates used for the production of biotechnological and biological products. Below is a detailed elaboration of ICH Q5D: 1. Purpose of ICH Q5D: ICH Q5D provides guidelines for the establishment of cell substrates used in the production of biotechnological and biological products. The primary goal is to ensure the quality, safety, and consistency of cell substrates to minimize potential risks associated with the final product. 2. Cell Substrate Characterization: The guideline emphasizes the importance of thorough characterization of the cell substrate. This includes the origin of the cells, their history, and any relevant genetic information. Detailed documentation of the cell line...

ICH E3 Structure and content of clinical study reports (CPMP/ICH/137/95)

 The ICH E3 guideline, titled "Structure and Content of Clinical Study Reports," with the reference number CPMP/ICH/137/95, provides recommendations and a standardized framework for the structure and content of clinical study reports (CSRs). CSRs are essential documents that summarize the results and findings of clinical trials conducted during the drug development process. Here's an elaboration of ICH E3: 1. Purpose: The primary purpose of ICH E3 is to provide guidance on the organization, content, and format of CSRs to ensure consistency and clarity in reporting clinical trial data. It aims to facilitate the evaluation of the safety and efficacy of investigational drugs by regulatory authorities. 2. Applicability: ICH E3 is applicable to CSRs for all phases of clinical trials, including Phase I, II, III, and post-marketing studies. 3. Structure of the CSR: The guideline outlines a standardized structure for the CSR, which typically includes the following sections: Title...

Overview of Cut Point Calculation in the Presence of Pre-existing Antibodies

The process involves statistical methods that account for variations in baseline ADA levels across the study population. Here’s a structured approach to calculate the cut point when there is a pre-existing antibody response: 1. Collect Baseline ADA Samples Sample Population : Collect samples from a representative population of treatment-naïve subjects (typically 50-100 individuals). These baseline samples should reflect the typical range of pre-existing ADA levels within the target patient population. Matrix Type : Use serum or plasma samples, as appropriate for the assay matrix. Time Points : Ideally, collect multiple samples per subject pre-treatment to get a clear baseline. 2. Run Baseline Samples in ADA Assay Perform the ADA assay on all baseline samples, running each sample in triplicate to account for intra-assay variability. Record the response values (e.g., optical density (OD) in ELISA) for each sample. If using multiple replicates, calculate the mean response for each sample....