Skip to main content

Stem loop RT-PCR for Detection of siRNA in Animal Tissues

Step Loop RT-PCR for Detection of Small Interfering RNA (siRNA)

The recent publications described a novel used the novel method for the detection of siRNAs using a TaqMan®-based approach. This approach utilizes similar strategy that has been used for microRNA detection. The approach is illustrated in below.  In brief, the RT step occurs in the presence of a stem-loop RT primer that is complementary to the last 6–10 bases of the 3′ end of the antisense strand of the target siRNA. The stem-loop primer contains an additional universal sequence at the 5′ end that facilitates a TaqMan-based detection strategy in the subsequent qPCR step. As in the case of microRNA, the forward primer for qPCR is sequence-specific for the target siRNA. For sequence compositions that yield a low predicted melting temperature (Tm), the forward primer is designed as a tailed primer to help increase Tm.


Stem Loop PCR for SiRNA Detection

Stem Loop PCR for SiRNA Detection


Step 1: Preparation of liver and plasma samples for the quantification of siRNA

For tissue, 500 ÎĽl of 0.25% Triton X-100 at 95°C was added directly into each 50 mg frozen powdered tissue sample. Lysates were vortexed and put back into the 95°C hot block for a total incubation time of 10 min. Lysates were vortexed twice more during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.

For plasma, plasma samples were diluted 1:10 in 0.25% Triton X-100. Then, 500 ÎĽl from each diluted plasma sample was heated at 95°C for a total incubation time of 10 min and vortexed twice during this incubation. Following 10 min at 95°C, all lysates were cooled on ice for 10 min.

All tissue and plasma lysates were centrifuged at 20,000 g for 20 min at 4°C and supernatants taken into clean Eppendorf tubes and kept on ice.

Reverse transcription preparation of cDNA

To determine tissue siRNA concentrations, ∼10 mg of powdered tissue was resuspended to a final concentration of 10 mg/mL in PBST. Diluted samples were incubated on a dry block (VWR® Advanced dry block heater; VWR) at 95°C for 10 min, vortexed, and placed on ice for 10 min before centrifugation at 16,000 g for 10 min at 4°C. Supernatants were transferred to 1.5 mL DNase/RNase-free tubes (Eppendorf, NY) and analyzed immediately or frozen until analysis.

A minimum of 20 ÎĽL of samples (plasma, serum, or liver), standards, and QCs was then transferred into a 96-well plate and placed into a preheated thermal cycler (Mastercycler®; Eppendorf) at 95°C for 10 min to allow the duplexes to denature and facilitate the annealing of the stem-loop primer to the antisense strand of the siRNA during the reverse transcription (RT) reaction.


Reverse transcription reactions

Reverse transcription reactions were performed using a TaqMan MicroRNA Reverse Transcription kit 200 (Applied Biosystems of Life Technologies, cat # 4366596).

It is recommended to use two adjacent PCR machines for the procedure. One PCR machine for heating the 'boiling plate' and the second for the 'RT plate', as detailed below.

A total of 50 ÎĽl from each standard curve point (single strand, duplex and formulated duplex), one naĂŻve (for background) and sample lysates were aliquoted into one PCR plate ('boiling plate') and heated at 95°C for 10 min on one PCR machine. Then, 10 ÎĽl of RT reaction mix (100 mmol deoxyribonucleotide triphosphates, 250 nmol stem and loop oligonucleotides, 20 U/ÎĽl RNase inhibitor, 1 × RT buffer, 50 U/ÎĽl MultiScribe Reverse Transcriptase) was aliquoted into each well of the 'RT plate', which was placed on the second adjacent PCR machine and kept at 4°C. Following 10 min of heating, the cover from the 'boiling plate' was removed and, while the plate was kept on the heating block, 5 ÎĽl from each hot sample was directly added into the RT reaction mix (at 4°C) on the 'RT plate' and the program was switched onto the RT program (30 min, 16°C, 30 min, 42°C, 5 min, 85°C).


PCR amplification

The qPCR step was then performed on a ViiA 7 Real-Time PCR System (Applied Biosystems; ThermoFisher Scientific) using a 384-well block and TaqMan™ Fast Advanced Master Mix (ThermoFisher Scientific) according to the manufacturer's protocols.

Primer
For the stem-loop primer, the universal sequence (5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC 3′) was used. Taqman probe, forward and reverse primer were designed based on the sequence.


Reference and Related Publications
https://doi.org/10.1089/nat.2019.0840
https://doi.org/10.1093/nar/gni178
https://doi.org/10.1186/1758-907X-1-16
https://doi.org/10.1016/j.ymthe.2017.12.021

Popular posts from this blog

Ago2 Immunoprecipitation for RISC-siRNA Quantitation

 Ago2 (Argonaute 2) immunoprecipitation (IP) is a technique used to isolate RNA-induced silencing complexes (RISC) from cell lysates. This method allows for the specific enrichment of active RISC complexes bound to small interfering RNA (siRNA) or microRNA (miRNA) within cells. By isolating these complexes, researchers can then quantify the siRNA associated with Ago2, which is an essential step in determining the efficacy of RISC loading and siRNA activity. Here’s a detailed overview of how Ago2 immunoprecipitation is performed for RISC-siRNA quantitation: Steps in Ago2 Immunoprecipitation for RISC-siRNA Quantitation Cell Lysis and Preparation of Lysate : Sample Preparation : Collect cells that have been treated with siRNA, then wash them with cold phosphate-buffered saline (PBS) to remove extracellular contaminants. Lysis : Lyse the cells in a gentle, RNA-preserving lysis buffer that typically includes detergents (e.g., NP-40 or Triton X-100), protease inhibitors, and RNase inhibi...

SOP on Investigator Delegation of Authority

Title: Investigator Delegation of Authority Introduction and Purpose: This Standard Operating Procedure (SOP) outlines the process by which the Principal Investigator (PI) delegates the authority to conduct clinical study procedures and tasks to sub-investigators and other study personnel. It also details the maintenance of documentation related to staff and investigator signatures and handwriting samples. Scope: The PI conducting a clinical trial must adhere to regulations governing informed consent (21 CFR 50) and regulations regarding Institutional Review Board (IRB) review and approval (21 CFR 56). If the study involves an investigational drug or device, additional regulations in 21 CFR 312 or 21 CFR 812 apply. Furthermore, all clinical study investigators should follow the International Council on Harmonization (ICH) guidelines for Good Clinical Practice (GCP). While these responsibilities are primarily held by the PI, they can be delegated to qualified sub-investigators and other...

ICH Q5D Derivation and characterisation of cell substrates used for production of biotechnological/biological products (CPMP/ICH/294/95)

The International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH) provides guidelines to ensure the quality, safety, and efficacy of pharmaceutical products. ICH Q5D, as outlined in document CPMP/ICH/294/95, addresses the derivation and characterization of cell substrates used for the production of biotechnological and biological products. Below is a detailed elaboration of ICH Q5D: 1. Purpose of ICH Q5D: ICH Q5D provides guidelines for the establishment of cell substrates used in the production of biotechnological and biological products. The primary goal is to ensure the quality, safety, and consistency of cell substrates to minimize potential risks associated with the final product. 2. Cell Substrate Characterization: The guideline emphasizes the importance of thorough characterization of the cell substrate. This includes the origin of the cells, their history, and any relevant genetic information. Detailed documentation of the cell line...

ICH Topic Q5E Comparability of biotechnological/biological products (CPMP/ICH/5721/03)

 ICH Topic Q5E, as outlined in document CPMP/ICH/5721/03, deals with the comparability of biotechnological and biological products. This guideline provides a structured framework for assessing and ensuring the comparability of different product versions, including changes during development, manufacturing, or post-approval phases. The goal is to demonstrate that changes made to a product do not adversely affect its quality, safety, or efficacy. Here's an elaboration of ICH Q5E: 1. Purpose of ICH Q5E: The primary purpose of ICH Q5E is to provide guidance on how to demonstrate the comparability of biotechnological and biological products, especially when changes are made to the manufacturing process or product characteristics. Comparability studies are crucial for ensuring the consistent quality and safety of these products. 2. Types of Changes Covered: ICH Q5E covers a wide range of changes, including modifications to the manufacturing process, changes in the manufacturing site, alt...

Safety Concerns for AAV Gene Therapy

 Adeno-associated virus (AAV) gene therapies have shown significant therapeutic promise, but they also carry risks, and toxicity signals are a primary safety concern. While generally well-tolerated, AAV-based therapies can trigger adverse effects ranging from immune-related responses to cellular toxicities, especially at higher doses. Here’s an overview of the key toxicity signals associated with AAV gene therapy, along with potential mechanisms and mitigation strategies: 1. Liver Toxicity Signal : Hepatotoxicity is one of the most common toxicity signals with AAV gene therapy, especially with high vector doses or in patients with pre-existing liver disease. Mechanism : AAV vectors, often targeting the liver, can cause liver inflammation due to: Immune responses to AAV capsids. Overexpression of the therapeutic transgene, leading to cellular stress. Clinical Signs : Elevated liver enzymes (ALT, AST) are common indicators of hepatotoxicity. Mitigation : Strategies include using immu...